pRZ-mOct4-CNL
(Plasmid
#65718)
-
PurposemOct4 reporter plasmid (expresses CNL)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRedZeo
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 5800
- Total vector size (bp) 7700
-
Vector typeLentiviral, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemurine Oct4 promoter and CNL
-
Alt namemOct4-CNL
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)1900
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer CGATTAGTGAACGGATCTCGACG
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypmTurquoise2-N1 (gifted from Dr Dorus Gadella Lab), mOct4 promoter sequence (System Biosciences)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRZ-mOct4-CNL was a gift from Yasushi Okada (Addgene plasmid # 65718 ; http://n2t.net/addgene:65718 ; RRID:Addgene_65718) -
For your References section:
Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23. 10.1073/pnas.1418468112 PubMed 25831507