Skip to main content
Addgene

pCNL-C1_PTS1
(Plasmid #65700)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65700 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCNL-C1
  • Backbone manufacturer
    Addgene #64307
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 5600
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    peroxisomal targeting signal 1 (tripeptide SKL)
  • Alt name
    PTS1
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    10
  • Promoter CMV
  • Tag / Fusion Protein
    • CNL (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GAGTTCGTGAAGGTGAAGGGCC
  • 3′ sequencing primer EBV Reverse
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pmTurquoise2-N1 (gifted from Dr Dorus Gadella Lab)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCNL-C1_PTS1 was a gift from Yasushi Okada (Addgene plasmid # 65700 ; http://n2t.net/addgene:65700 ; RRID:Addgene_65700)
  • For your References section:

    Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23. 10.1073/pnas.1418468112 PubMed 25831507