pONL-N1_LAMP1
(Plasmid
#65686)
-
PurposeExpresses LAMP1-ONL in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65686 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepONL-N1
-
Backbone manufacturerAddgene #64305
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 6800
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLAMP1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1200
- Promoter CMV
-
Tag
/ Fusion Protein
- ONL (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer CATGCCCATTGACGGAGCCGTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhmKusabiraOrange2 (gifted from Dr Atsushi Miyawaki)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lamp-1 sequence contains a D50E mutation, which should not affect plasmid function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pONL-N1_LAMP1 was a gift from Yasushi Okada (Addgene plasmid # 65686 ; http://n2t.net/addgene:65686 ; RRID:Addgene_65686) -
For your References section:
Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23. 10.1073/pnas.1418468112 PubMed 25831507