MSCV_Cas9_puro
(Plasmid #65655)

• Purpose: Retroviral introduction of Cas9 into mammalian cell line.
• Depositing Lab: Christopher Vakoc
• Publication: Shi et al Nat Biotechnol. 2015 May 11. doi: 10.1038/nbt.3235.

Backbone

• Vector backbone: MSCV_puro
• Backbone manufacturer: clontech
• Backbone size w/o insert (bp): 6200
• Total vector size (bp): 10475
• Vector type: Mammalian Expression, Retroviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9
• Alt name: S. pyogenes CRISPR-Cas9
• Species: Synthetic
• Insert Size (bp): 4200
• Promoter: MSSV_LTR
• Tag / Fusion Protein:
  • 5 ' FLAG tag

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: the human Cas9 coding sequence is PCR cloned from lentiCRISPR-Cas9 plasmid (Addgene: # 49535)
• Articles Citing this Plasmid:
  • 17 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry