pIRESpuro2 AXL
(Plasmid #65627)

• Purpose: Expresses AXL on cistronic transcript with puro resistance in mammalian cells
• Depositing Lab: Aaron Meyer
• Publication: Meyer et al Cell Syst. 2015 Jul 29;1(1):25-36.

Backbone

• Vector backbone: pIRESpuro2
• Backbone manufacturer: CloneTech
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 7805
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tyrosine-protein kinase receptor UFO
• Alt name: AXL
• Alt name: UFO
• Species: H. sapiens (human)
• Insert Size (bp): 2838
• Mutation: Spurious PDPRPHR on C terminus
• GenBank ID: NM_001699.5
• Entrez Gene: AXL (a.k.a. ARK, AXL3, JTK11, Tyro7, UFO)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Supplemental Documents:
  • Genebank
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry