Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PAS505 (TJF068)
(Plasmid #65572)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65572 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 7084
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Mach1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FadD with V451A mutation
  • Species
    E. coli
  • Insert Size (bp)
    1686
  • Mutation
    V451A
  • Promoter T7 lacO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer ctcgatcccgcgaaattaatacg
  • 3′ sequencing primer CTTAAGCATTATGCGGCCGCAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PAS505 (TJF068) was a gift from Pamela Silver (Addgene plasmid # 65572 ; http://n2t.net/addgene:65572 ; RRID:Addgene_65572)
  • For your References section:

    Enhancement of E. coli acyl-CoA synthetase FadD activity on medium chain fatty acids. Ford TJ, Way JC. PeerJ. 2015 Jun 30;3:e1040. doi: 10.7717/peerj.1040. eCollection 2015. 10.7717/peerj.1040 PubMed 26157619