attB-mCh-Dnmt3b6-Poly(A)-NeoR
(Plasmid #65554)

• Purpose: Plasmid for Bxb1-mediated recombination of the mCh-Dnmt3b6 cDNA into a MIN-tagged locus using Neomycin selection
• Depositing Lab: Sebastian Bultmann
• Publication: Mulholland et al Nucleic Acids Res. 2015 May 24. pii: gkv550.

Backbone

• Vector backbone: attB-mCh-Poly(A)-NeoR
• Vector type: Mammalian Expression, Mouse Targeting ; Bxb1
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Dnmt3b
• Species: M. musculus (mouse)
• Mutation: isoform 6
• Entrez Gene: Dnmt3b (a.k.a. MmuIIIB)
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AsiSI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: CGATCACATGGTCCTGCTGG
• 3′ sequencing primer: gtggtttgtccaaactcatc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry