pFLIP39
(Plasmid
#65507)
-
Purpose(Empty Backbone) FRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65507 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepRSET-B
-
Backbone manufacturerInvitrogen
- Backbone size (bp) 2850
-
Modifications to backboneNone
-
Vector typeBacterial Expression
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- 6His-edAFPt9-attR1 (N terminal on backbone)
- attR2-t7edCFPt9-cMyc (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACAAGTTTGTACAAAAAAGCA
- 3′ sequencing primer ACCACTTTGTACAAGAAAGCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFLIP39 was a gift from Wolf Frommer (Addgene plasmid # 65507 ; http://n2t.net/addgene:65507 ; RRID:Addgene_65507) -
For your References section:
Abscisic acid dynamics in roots detected with genetically encoded FRET sensors. Jones AM, Danielson JA, Manojkumar SN, Lanquar V, Grossmann G, Frommer WB. eLife. 2014 Apr 15;3:e01741. doi: 10.7554/eLife.01741. PubMed 24737862
