IRES-GFP-AXL-KD
(Plasmid #65498)

• Purpose: Expresses kinase dead AXL in mammalian cells with cistronic EGFP
• Depositing Lab: Aaron Meyer
• Publication: Meyer et al Cell Syst. 2015 Jul 29;1(1):25-36.

Backbone

• Vector backbone: pIRES2-EGFP
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 5300
• Total vector size (bp): 7927
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tyrosine-protein kinase receptor UFO
• Alt name: AXL
• Alt name: UFO
• Alt name: AXL oncogene
• Species: H. sapiens (human)
• Insert Size (bp): 2682
• Mutation: K567R
• GenBank ID: AAH32229.1
• Entrez Gene: AXL (a.k.a. ARK, AXL3, JTK11, Tyro7, UFO)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CTGGTCGAGCTGGACGGCGACG

Resource Information

• Supplemental Documents:
  • Genebank file
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry