Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTre-Tight-luciferase-GFP (467)
(Plasmid #65491)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65491 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTre-tight-SV40-luciferase
  • Backbone manufacturer
    Guigo lab, Addgene plasmid 65489
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    734
  • Promoter tight TRE promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer C328F AGGCGTATCACGAGGCCCTTTCGT
  • 3′ sequencing primer C328R TATTACCGCCTTTGAGTGAGCTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Compared to the provided full plasmid sequence, Addgene's quality control sequencing finds an L27F amino acid residue substitution in the EGFP fluorophore. The depositing laboratory is aware of this residue change, and it does not affect fluorophore function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTre-Tight-luciferase-GFP (467) was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 65491 ; http://n2t.net/addgene:65491 ; RRID:Addgene_65491)