GFP_CD47_LU
(Plasmid #65474)

• Purpose: GFP tagged CD47 with its own long 3'UTR
• Depositing Lab: Christine Mayr
• Publication: Berkovits et al Nature. 2015 Apr 20. doi: 10.1038/nature14321.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5372
• Total vector size (bp): 11262
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Signal peptide of CD47
• Species: H. sapiens (human)
• Insert Size (bp): 60
• GenBank ID: NM_001777.3

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: T7

Gene/Insert 2

• Gene/Insert name: GFP
• GenBank ID:

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: T7

Gene/Insert 3

• Gene/Insert name: CD47 coding region continued and long 3’UTR (with proximal polyadenylation signal changed from AAUAAA to ACUCAA).
• Insert Size (bp): 5116
• GenBank ID: NM_001777.3

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GGTGAACTTCAAGATCCGCC
• 3′ sequencing primer: BGH Rev

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry