pKS011
(Plasmid
#65464)
-
PurposepSC101 based plasmid where pl-tetO expression drives synthesis of construct expressing (N to C terminal) MBP (Maltose Binding Protein), Ntag, and mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65464 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSC101
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMBP-Ntag-mCherry
-
Insert Size (bp)2270
- Promoter pl-TetO
-
Tags
/ Fusion Proteins
- MBP
- FLAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCGTATCACGAGGCCCTTTC
- 3′ sequencing primer GGATAACAGAAAGGCCGGGAAATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKS011 was a gift from Keith Tyo (Addgene plasmid # 65464 ; http://n2t.net/addgene:65464 ; RRID:Addgene_65464) -
For your References section:
N-Terminal-Based Targeted, Inducible Protein Degradation in Escherichia coli. Sekar K, Gentile AM, Bostick JW, Tyo KE. PLoS One. 2016 Feb 22;11(2):e0149746. doi: 10.1371/journal.pone.0149746. eCollection 2016. PONE-D-15-42990 [pii] PubMed 26900850