FUW-ubiquitin-SV40-RFP
(Plasmid
#65448)
-
PurposeExpression of RFP in mammalian cells. Control vector for FUW-Ephrin-RFP vectors
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFUW
-
Backbone manufacturerAddgene Plasmid 14882
- Total vector size (bp) 10327
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSV40-RFP
-
Alt namemRFP
-
Insert Size (bp)727
- Promoter UBQ
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer hUBCpro-F
- 3′ sequencing primer mRFP1-R GGAGCCGTACTGGAACTGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-ubiquitin-SV40-RFP was a gift from Eduard Batlle (Addgene plasmid # 65448 ; http://n2t.net/addgene:65448 ; RRID:Addgene_65448) -
For your References section:
EphB-ephrin-B interactions suppress colorectal cancer progression by compartmentalizing tumor cells. Cortina C, Palomo-Ponce S, Iglesias M, Fernandez-Masip JL, Vivancos A, Whissell G, Huma M, Peiro N, Gallego L, Jonkheer S, Davy A, Lloreta J, Sancho E, Batlle E. Nat Genet. 2007 Nov;39(11):1376-83. Epub 2007 Sep 30. 10.1038/ng.2007.11 PubMed 17906625