pRecLV103-GFP-PGBD5
(Plasmid
#65409)
-
PurposeLentiviral expression vector for fusion of GFP with human PGBD5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRecLV103
-
Backbone manufacturerGenecopeia
- Backbone size w/o insert (bp) 8800
- Total vector size (bp) 10100
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePGBD5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1500
-
GenBank IDAAI50639.1
-
Entrez GenePGBD5
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer agaacatggtggtgcagaca
- 3′ sequencing primer TACAAGGTCCAGCCCTTCC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRecLV103-GFP-PGBD5 was a gift from Alex Kentsis (Addgene plasmid # 65409 ; http://n2t.net/addgene:65409 ; RRID:Addgene_65409) -
For your References section:
Genomic DNA transposition induced by human PGBD5. Henssen AG, Henaff E, Jiang E, Eisenberg AR, Carson JR, Villasante CM, Ray M, Still E, Burns M, Gandara J, Feschotte C, Mason CE, Kentsis A. Elife. 2015 Sep 25;4. pii: e10565. doi: 10.7554/eLife.10565. 10.7554/eLife.10565 PubMed 26406119