pcDNA3-PTK7-VSV
(Plasmid #65250)

• Purpose: Expression of VSV tagged PTK7 in mammalian cells
• Depositing Lab: Axel Ullrich
• Publication: Gartner et al PLoS One. 2014 Jan 7;9(1):e84472. doi: 10.1371/journal.pone.0084472. eCollection 2014.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5446
• Total vector size (bp): 8689
• Modifications to backbone: in-frame VSV tag between ApaI and XhoI sites of pcDNA3
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PTK7
• Alt name: CCK4
• Species: H. sapiens (human)
• Insert Size (bp): 3243
• Entrez Gene: PTK7 (a.k.a. CCK-4, CCK4)
• Promoter: CMV
• Tag / Fusion Protein:
  • VSV (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CACTGCTTACTGGCTTATCG
• 3′ sequencing primer: TGGCAACTAGAAGGCACAG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry