Skip to main content
Addgene

shCTL-mlpx-neo
(Plasmid #65233)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65233 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMLPX
  • Backbone size w/o insert (bp) 6728
  • Total vector size (bp) 6820
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    non-coding shRNA
  • gRNA/shRNA sequence
    CGCGAAGTCTGTACTCTTG
  • Species
    H. sapiens (human)
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cccttgaacctcctcGttcgac
  • 3′ sequencing primer CTTCGCGCCACCTTCTACTCCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shCTL-mlpx-neo was a gift from Gerardo Ferbeyre (Addgene plasmid # 65233 ; http://n2t.net/addgene:65233 ; RRID:Addgene_65233)
  • For your References section:

    Tumor suppressor activity of the ERK/MAPK pathway by promoting selective protein degradation. Deschenes-Simard X, Gaumont-Leclerc MF, Bourdeau V, Lessard F, Moiseeva O, Forest V, Igelmann S, Mallette FA, Saba-El-Leil MK, Meloche S, Saad F, Mes-Masson AM, Ferbeyre G. Genes Dev. 2013 Apr 15;27(8):900-15. doi: 10.1101/gad.203984.112. Epub 2013 Apr 18. 10.1101/gad.203984.112 PubMed 23599344