-
PurposeExpression of Axl in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLXSN
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 8600
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAXL
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2700
-
GenBank IDNM_021913
-
Entrez GeneAXL (a.k.a. ARK, AXL3, JTK11, Tyro7, UFO)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CTCTCCCCCTTGAACCTC
- 3′ sequencing primer GACTTTCCACACCCTAACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLXSN-Axl was a gift from Axel Ullrich (Addgene plasmid # 65222 ; http://n2t.net/addgene:65222 ; RRID:Addgene_65222) -
For your References section:
AXL is a potential target for therapeutic intervention in breast cancer progression. Zhang YX, Knyazev PG, Cheburkin YV, Sharma K, Knyazev YP, Orfi L, Szabadkai I, Daub H, Keri G, Ullrich A. Cancer Res. 2008 Mar 15;68(6):1905-15. doi: 10.1158/0008-5472.CAN-07-2661. 10.1158/0008-5472.CAN-07-2661 PubMed 18339872