pSR646
(Plasmid #65215)

• Purpose: Baculovirus-mediated rAAV production: Expresses bicistronic AAV-2 rep gene and polycistronic AAV-6 cap gene in Sf9 insect cells
• Depositing Lab: Robert Kotin
• Publication: Smith et al Mol Ther. 2009 Nov;17(11):1888-96. doi: 10.1038/mt.2009.128. Epub 2009 Jun 16.

Backbone

• Vector backbone: pFastBac-Dual
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5238
• Total vector size (bp): 9335
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: modified AAV-2 rep78
• Insert Size (bp): 1866
• Promoter: polyhedrin

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: AAATGATAACCATCTCGC
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Gene/Insert 2

• Gene/Insert name: modified AAV-6 cap
• Insert Size (bp): 2211
• Promoter: P10

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: ACGGACCTTTAATTCAACCCA
• 3′ sequencing primer: CTTCCGTGTTTCAGTTAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Rep78 ORF utilizes a non-canonical initiation codon (CTG codon) beginning at nt 6822.

VP1 capsid ORF utilizes a non-canonical initiation codon (TTG codon) beginning at nt 6514.

Additional article references: Barbash et al. Gene Therapy 20: 274-282 (2013).