Skip to main content
Addgene

SLC30A10-delta105-107
(Plasmid #65205)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65205 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMV-Flag-10
  • Backbone manufacturer
    Sigma
  • Backbone size w/o insert (bp) 6400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SLC30A10
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1446
  • Mutation
    delta 105-107 amino acids
  • Entrez Gene
    SLC30A10 (a.k.a. HMDPC, HMNDYT1, ZNT10, ZNT8, ZRC1, ZnT-10)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer C-CMV-24 (TATTAGGACAAGGCTGGTGGGCAC)
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SC30A10 WT received from Dr. Ruth Valentine

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Amino acids 105-107 were deleted by Quikchange.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SLC30A10-delta105-107 was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 65205 ; http://n2t.net/addgene:65205 ; RRID:Addgene_65205)

  • For your References section:

    SLC30A10 is a cell surface-localized manganese efflux transporter, and parkinsonism-causing mutations block its intracellular trafficking and efflux activity. Leyva-Illades D, Chen P, Zogzas CE, Hutchens S, Mercado JM, Swaim CD, Morrisett RA, Bowman AB, Aschner M, Mukhopadhyay S. J Neurosci. 2014 Oct 15;34(42):14079-95. doi: 10.1523/JNEUROSCI.2329-14.2014. 10.1523/JNEUROSCI.2329-14.2014 PubMed 25319704
Related items:
Commonly requested with: