pcDNA3-ADAM17-HA
(Plasmid #65105)

• Purpose: Expression of HA tagged ADAM17 (TACE) in mammalian cells
• Depositing Lab: Axel Ullrich
• Publication: Gschwind et al EMBO J. 2003 May 15;22(10):2411-21.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5446
• Total vector size (bp): 7920
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ADAM17
• Alt name: TACE
• Species: H. sapiens (human)
• Insert Size (bp): 2474
• GenBank ID: NM_003183
• Entrez Gene: ADAM17 (a.k.a. ADAM18, CD156B, CSVP, NISBD, NISBD1, TACE)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CACTGCTTACTGGCTTATCG
• 3′ sequencing primer: TGGCAACTAGAAGGCACAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert was PCR amplified from human placenta cDNA.
Insert contains several point mutations compared to NM_003183 (see sequence)