Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLVTH-shNP1
(Plasmid #65062)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65062 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLVTH
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 11090
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shNP1
  • gRNA/shRNA sequence
    GATCCCCGTACAGCCGCCTCAATTCTTTCAAGAGAAGAATTGAGGCGGCTGTACTTTTT
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    59
  • Entrez Gene
    Nptx1
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer H1
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVTH-shNP1 was a gift from Ramon Trullas (Addgene plasmid # 65062 ; http://n2t.net/addgene:65062 ; RRID:Addgene_65062)
  • For your References section:

    Neuronal pentraxin 1 negatively regulates excitatory synapse density and synaptic plasticity. Figueiro-Silva J, Gruart A, Clayton KB, Podlesniy P, Abad MA, Gasull X, Delgado-Garcia JM, Trullas R. J Neurosci. 2015 Apr 8;35(14):5504-21. doi: 10.1523/JNEUROSCI.2548-14.2015. 10.1523/JNEUROSCI.2548-14.2015 PubMed 25855168