pET28b-His tagged nuclear Pif1
(Plasmid #65047)

• Purpose: expression of the nuclear form of Pif1p (Pif1p-delta40), Nterminal His tag
• Depositing Labs: Jean-Baptiste Boulé, Virgina Zakian
• Publication: Boule et al Nature. 2005 Nov 3;438(7064):57-61. Epub 2005 Aug 24.

Backbone

• Vector backbone: pET28b(+)
• Backbone manufacturer: novagen
• Backbone size w/o insert (bp): 5254
• Total vector size (bp): 7777
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Yeast Pif1, nuclear form, N-terminal 6x His-tag
• Alt name: yPIF1delta40
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2523
• GenBank ID: NM_001182420
• Entrez Gene: PIF1 (a.k.a. YML061C, TST1)
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • histag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pET-28b(+)-PIF1delta40.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry