Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28b-His tagged nuclear Pif1
(Plasmid #65047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65047 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28b(+)
  • Backbone manufacturer
    novagen
  • Backbone size w/o insert (bp) 5254
  • Total vector size (bp) 7777
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Yeast Pif1, nuclear form, N-terminal 6x His-tag
  • Alt name
    yPIF1delta40
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2523
  • GenBank ID
    NM_001182420
  • Entrez Gene
    PIF1 (a.k.a. YML061C, TST1)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • histag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28b-His tagged nuclear Pif1 was a gift from Jean-Baptiste Boulé & Virgina Zakian (Addgene plasmid # 65047 ; http://n2t.net/addgene:65047 ; RRID:Addgene_65047)
  • For your References section:

    The yeast Pif1p helicase removes telomerase from telomeric DNA. Boule JB, Vega LR, Zakian VA. Nature. 2005 Nov 3;438(7064):57-61. Epub 2005 Aug 24. 10.1038/nature04091 PubMed 16121131