-
PurposeE. coli reporter vector with MCS for inserting bacterial promoter region through 5' end of gene of interest, upstream and in-frame with mCherry reporter.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCRISPReporter (pETM6/pET-Duet-1)
- Backbone size w/o insert (bp) 4343
- Total vector size (bp) 5011
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesSynthetic; Codon-optimized for E. coli expression
-
Insert Size (bp)708
- Promoter User-defined
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GGGCCCGCTGGGAGTTCGTAG
- 3′ sequencing primer GTCGAGGTGCCGTAAAGCACTAAATCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPReporter-mCherry was a gift from Mattheos Koffas (Addgene plasmid # 65008 ; http://n2t.net/addgene:65008 ; RRID:Addgene_65008) -
For your References section:
CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. Cress BF, Toparlak OD, Guleria S, Lebovich M, Stieglitz JT, Englaender JA, Jones JA, Linhardt RJ, Koffas MA. ACS Synth Biol. 2015 Mar 30. 10.1021/acssynbio.5b00012 PubMed 25822415