Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pASKt15C+SrtA7
(Plasmid #64986)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64986 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pASK-IBA3 plus
  • Backbone manufacturer
    IBA
  • Backbone size w/o insert (bp) 3211
  • Total vector size (bp) 3772
  • Modifications to backbone
    The ampicillin-resistance gene is replaced with a chloramphenicol-resistance gene. The pBR322 replicon is replaced with a p15A replicon.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sortase A
  • Alt name
    SrtA
  • Species
    Staphylococcus aureus ATCC 10832
  • Insert Size (bp)
    566
  • Mutation
    deleted amino acids 1-59, P94R, E105K, E108A, D160N, D165A, K190E, K196T
  • Promoter tetracycline promoter/operator
  • Tags / Fusion Proteins
    • His6 tag (N terminal on insert)
    • S tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer GAGTTATTTTACCACTCCCT
  • 3′ sequencing primer CGCAGTAGCGGTAAACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    S. aureus sortase A is originally cloned from a genomic DNA of S. aureus (ATCC 10832D) in our lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pASKt15C+SrtA7 was a gift from Teruyuki Nagamune (Addgene plasmid # 64986 ; http://n2t.net/addgene:64986 ; RRID:Addgene_64986)
  • For your References section:

    Ca -independent sortase-A exhibits high selective protein ligation activity in the cytoplasm of E. coli. Hirakawa H, Ishikawa S, Nagamune T. Biotechnol J. 2015 Apr 10. doi: 10.1002/biot.201500012. 10.1002/biot.201500012 PubMed 25864513