pASKt15C+SrtA2
(Plasmid #64984)

• Purpose: Expresses the E105K/E108A mutant of Staphylococcus aureus sortase A in E. coli
• Depositing Lab: Teruyuki Nagamune
• Publication: Hirakawa et al Biotechnol J. 2015 Apr 10. doi: 10.1002/biot.201500012.

Backbone

• Vector backbone: pASK-IBA3 plus
• Backbone manufacturer: IBA
• Backbone size w/o insert (bp): 3211
• Total vector size (bp): 3772
• Modifications to backbone: The ampicillin-resistance gene is replaced with a chloramphenicol-resistance gene. The pBR322 replicon is replaced with a p15A replicon.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sortase A
• Alt name: SrtA
• Species: Staphylococcus aureus ATCC 10832
• Insert Size (bp): 566
• Mutation: deleted amino acids 1-59, E105K, E108A
• Promoter: tetracycline promoter/operator
• Tags / Fusion Proteins:
  • His6 tag (N terminal on insert)
  • S tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: GAGTTATTTTACCACTCCCT
• 3′ sequencing primer: CGCAGTAGCGGTAAACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: S. aureus sortase A is originally cloned from a genomic DNA of S. aureus (ATCC 10832D) in our lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry