human syndecan 2 EFYA
(Plasmid
#64971)
-
PurposeConstitutive expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64971 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5400
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesyndecan 2
-
SpeciesH. sapiens (human)
-
Mutationdeleted EFYA
-
Entrez GeneSDC2 (a.k.a. CD362, HSPG, HSPG1, SYND2)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CMV-F
- 3′ sequencing primer BGH-rev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (EFYA).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
human syndecan 2 EFYA was a gift from Enric Espel (Addgene plasmid # 64971 ; http://n2t.net/addgene:64971 ; RRID:Addgene_64971) -
For your References section:
The PDZ-binding domain of syndecan-2 inhibits LFA-1 high-affinity conformation. Rovira-Clave X, Angulo-Ibanez M, Reina M, Espel E. Cell Signal. 2014 Jul;26(7):1489-99. doi: 10.1016/j.cellsig.2014.03.012. Epub 2014 Mar 21. 10.1016/j.cellsig.2014.03.012 PubMed 24662262