human syndecan 2 EFYA
(Plasmid #64971)

• Purpose: Constitutive expression in mammalian cells
• Depositing Lab: Enric Espel
• Publication: Rovira-Clave et al Cell Signal. 2014 Jul;26(7):1489-99. doi: 10.1016/j.cellsig.2014.03.012. Epub 2014 Mar 21.

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5400
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: syndecan 2
• Species: H. sapiens (human)
• Mutation: deleted EFYA
• Entrez Gene: SDC2 (a.k.a. CD362, HSPG, HSPG1, SYND2)
• Promoter: CMV

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: BGH-rev

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (EFYA).