pGFP
(Plasmid
#64904)
-
Purpose"Fluorescent reporter containing no disulfide bonds/Selenocystamine folding"
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepsbA
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 8726
-
Vector typepsbA Chlamydomonas reinhardtii vector
-
Selectable markerskanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGreen fluorescent protein
-
Alt nameGFP
-
SpeciesAequorea victoria
-
Insert Size (bp)726
- Promoter psbA
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gtgctaggtaactaacgtttgattttt
- 3′ sequencing primer cGGATCCTACGTAGGCGCCGAATTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP was a gift from Stephen Mayfield (Addgene plasmid # 64904 ; http://n2t.net/addgene:64904 ; RRID:Addgene_64904) -
For your References section:
Selenocystamine improves protein accumulation in chloroplasts of eukaryotic green algae. Ferreira-Camargo LS, Tran M, Beld J, Burkart MD, Mayfield SP. AMB Express. 2015 Dec;5(1):126. doi: 10.1186/s13568-015-0126-3. Epub 2015 Jul 3. 10.1186/s13568-015-0126-3 PubMed 26137911
Map uploaded by the depositor.