Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TetO-FUW-NfiA
(Plasmid #64901)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64901 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    TetO-FUW
  • Backbone size w/o insert (bp) 8421
  • Total vector size (bp) 9971
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nfia
  • Alt name
    Ctf
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1558
  • GenBank ID
    18027
  • Entrez Gene
    Nfia (a.k.a. 1110047K16Rik, 9430022M17Rik, CTF, NF1-A, NF1A)
  • Promoter TetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hpa (destroyed during cloning)
  • 3′ cloning site Nhe (not destroyed)
  • 5′ sequencing primer GCAGAGCTCGTTTAGTGAACCGTC
  • 3′ sequencing primer AGCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    NfiA coding was kindly Provided by Dr G. Messina
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TetO-FUW-NfiA was a gift from Vania Broccoli (Addgene plasmid # 64901 ; http://n2t.net/addgene:64901 ; RRID:Addgene_64901)
  • For your References section:

    Direct conversion of fibroblasts into functional astrocytes by defined transcription factors. Caiazzo M, Giannelli S, Valente P, Lignani G, Carissimo A, Sessa A, Colasante G, Bartolomeo R, Massimino L, Ferroni S, Settembre C, Benfenati F, Broccoli V. Stem Cell Reports. 2015 Jan 13;4(1):25-36. doi: 10.1016/j.stemcr.2014.12.002. Epub 2014 Dec 31. 10.1016/j.stemcr.2014.12.002 PubMed 25556566