Skip to main content
Addgene

pAAV-CMV-iRFP
(Plasmid #64887)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64887 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-CMV
  • Backbone manufacturer
    Cell Biolabs
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iRFP
  • Species
    Rhodopseudomonas palustris
  • Insert Size (bp)
    948
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer pCAX-F (CAGCTCCTGGGCAACGTGC)
  • 3′ sequencing primer C-CMV-24 (TATTAGGACAAGGCTGGTGGGCAC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The iRFP insert from pShuttle-CMV-iRFP DNA plasmid (Addgene Plasmid 31856) was used for pAAV-CMV-iRFP.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-iRFP was a gift from Tomomi Ichinose (Addgene plasmid # 64887 ; http://n2t.net/addgene:64887 ; RRID:Addgene_64887)
  • For your References section:

    Marking cells with infrared fluorescent proteins to preserve photoresponsiveness in the retina. Fyk-Kolodziej B, Hellmer CB, Ichinose T. Biotechniques. 2014 Nov 1;57(5):245-53. doi: 10.2144/000114228. eCollection 2014 Nov. 10.2144/000114228 PubMed 25391913