pAAV-CMV-iRFP
(Plasmid #64887)

• Purpose: Marking retinal neurons with infrared fluorescent proteins (iRFP) to preserve photoresponsiveness
• Depositing Lab: Tomomi Ichinose
• Publication: Fyk-Kolodziej et al Biotechniques. 2014 Nov 1;57(5):245-53. doi: 10.2144/000114228. eCollection 2014 Nov.

Backbone

• Vector backbone: pAAV-CMV
• Backbone manufacturer: Cell Biolabs
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: iRFP
• Species: Rhodopseudomonas palustris
• Insert Size (bp): 948
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: pCAX-F (CAGCTCCTGGGCAACGTGC)
• 3′ sequencing primer: C-CMV-24 (TATTAGGACAAGGCTGGTGGGCAC)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The iRFP insert from pShuttle-CMV-iRFP DNA plasmid (Addgene Plasmid 31856) was used for pAAV-CMV-iRFP.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry