pCDH-EF1-FHC-POLQ-S1977P
(Plasmid #64876)

• Purpose: lentiviral expression of human POLQ S1977P mutant (mimicks the chaos1 mutation)
• Depositing Lab: Richard Wood
• Publication: Yousefzadeh et al PLoS Genet. 2014 Oct 2;10(10):e1004654. doi: 10.1371/journal.pgen.1004654. eCollection 2014 Oct.

Backbone

• Vector backbone: pCDH-EF1-FHC
• Backbone manufacturer: Wood Lab, Addgene plasmid 64874
• Total vector size (bp): 15236
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: POLQ
• Species: H. sapiens (human)
• Mutation: S1977P, mimicking the chaos1 mutation
• Entrez Gene: POLQ (a.k.a. PRO0327)
• Promoter: EF1alpha
• Tags / Fusion Proteins:
  • FLAG (C terminal on backbone)
  • HA (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: EF1a-F_alt (gccgtgaacgttctttttc)
• 3′ sequencing primer: IRES-R (CCTCACATTGCCAAAAGACG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry