shh10
(Plasmid #64867)

• Purpose: This plasmid can be used in the triple transfection method of AAV vector production. It supplies the replication proteins from AAV2 and the engineered shh10 capsid protein.
• Depositing Labs: John Flannery, David Schaffer
• Publication: Klimczak et al PLoS One. 2009 Oct 14;4(10):e7467. doi: 10.1371/journal.pone.0007467.

Backbone

• Vector backbone: XX2
• Backbone manufacturer: University of North Carolina Dr. Samulski
• Backbone size w/o insert (bp): 5648
• Total vector size (bp): 8182
• Modifications to backbone: replaced AAV2 cap with shh10 cap
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: shh10 cap
• Species: Adeno-associated virus - 6
• Insert Size (bp): 2211
• Mutation: I319V, N451D, D532N

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GCGGAAGCTTCGATCAACTACGC
• 3′ sequencing primer: GCAGTGCCAGGGTTGATTATAG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry