-
Purpose(Empty Backbone) Empty vector for lncRNA expression
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64865 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepSIREN-RetroQZsGreen
-
Backbone manufacturerClontech
- Backbone size (bp) 6600
-
Modifications to backboneU6 promoter and partial sequence downstream ZsGreen was removed from the backbone.
-
Vector typeRetroviral
- Promoter CMV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer gagctggtttagtgaacggtca
- 3′ sequencing primer cctacaggtggggtctttca (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLncEXP was a gift from Lei Sun (Addgene plasmid # 64865 ; http://n2t.net/addgene:64865 ; RRID:Addgene_64865) -
For your References section:
De Novo Reconstruction of Adipose Tissue Transcriptomes Reveals Long Non-coding RNA Regulators of Brown Adipocyte Development. Alvarez-Dominguez JR, Bai Z, Xu D, Yuan B, Lo KA, Yoon MJ, Lim YC, Knoll M, Slavov N, Chen S, Chen P, Lodish HF, Sun L. Cell Metab. 2015 May 5;21(5):764-76. doi: 10.1016/j.cmet.2015.04.003. Epub 2015 Apr 23. 10.1016/j.cmet.2015.04.003 PubMed 25921091
Map uploaded by the depositor.
