Skip to main content
Addgene

PMKO-shNC
(Plasmid #64863)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64863 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMKO.1 GFP
  • Backbone size w/o insert (bp) 6700
  • Total vector size (bp) 6700
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Scrambled shRNA
  • gRNA/shRNA sequence
    CAACAAGATGAAGAGCACCAA
  • Promoter u6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pLXSN 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PMKO-shNC was a gift from Lei Sun (Addgene plasmid # 64863 ; http://n2t.net/addgene:64863 ; RRID:Addgene_64863)
  • For your References section:

    De Novo Reconstruction of Adipose Tissue Transcriptomes Reveals Long Non-coding RNA Regulators of Brown Adipocyte Development. Alvarez-Dominguez JR, Bai Z, Xu D, Yuan B, Lo KA, Yoon MJ, Lim YC, Knoll M, Slavov N, Chen S, Chen P, Lodish HF, Sun L. Cell Metab. 2015 May 5;21(5):764-76. doi: 10.1016/j.cmet.2015.04.003. Epub 2015 Apr 23. 10.1016/j.cmet.2015.04.003 PubMed 25921091
Commonly requested with: