7M8
(Plasmid #64839)

• Purpose: This plasmid can be used in the triple transfection method of AAV vector production. It supplies the replication proteins from AAV2 and the 7M8 capsid protein.
• Depositing Labs: John Flannery, David Schaffer
• Publication: Dalkara et al Sci Transl Med. 2013 Jun 12;5(189):189ra76. doi: 10.1126/scitranslmed.3005708.

Backbone

• Vector backbone: XX2
• Backbone manufacturer: University of North Carolina Dr. Samulski
• Backbone size w/o insert (bp): 5648
• Total vector size (bp): 8209
• Modifications to backbone: replaced AAV2 cap with 7M8 cap
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 7M8 cap
• Species: Adeno-associated virus - 2
• Insert Size (bp): 2238
• Mutation: 7mer insertion in the AAV2 cap

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GCGGAAGCTTCGATCAACTACGC
• 3′ sequencing primer: gtgcggcaaagtttgcttcc

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 11 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Discrepancies found during QC have no functional consequence.