pLVX-IRES-tdTomato-FlagAkt1W80A
(Plasmid #64833)

• Purpose: cDNA of Akt1 with point mutation from Trp to Ala at position 80. This mutation confers resistance to the MK-2206 drug
• Depositing Lab: Eva Gonzalez
• Publication: Kajno et al Biochem J. 2015 Apr 9.

Backbone

• Vector backbone: pLVX-IRES-tdTomato
• Backbone size w/o insert (bp): 8892
• Total vector size (bp): 10404
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Akt1
• Alt name: PKBalpha
• Species: M. musculus (mouse)
• Insert Size (bp): 1512
• Mutation: Point mutation from Trp to Ala at position 80
• GenBank ID: NM_009652
• Entrez Gene: Akt1 (a.k.a. Akt, LTR-akt, PKB, PKB/Akt, PKBalpha, Rac)
• Promoter: CMV
• Tag / Fusion Protein:
  • 3xFlag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Eco RI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GACCTCCATAGAAGACACCGACT
• 3′ sequencing primer: GCCTTATTCCAAGCGGCTTCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry