pLVX-IRES-tdTomato-FlagAkt2
(Plasmid #64832)

• Purpose: Lentiviral expression of murine Flag-Akt2
• Depositing Lab: Eva Gonzalez
• Publication: Kajno et al Biochem J. 2015 Apr 9.

Backbone

• Vector backbone: pLVX-IRES-tdTomato
• Backbone size w/o insert (bp): 8892
• Total vector size (bp): 10407
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Akt2
• Alt name: PKBbeta, thymoma viral proto-oncogene 2
• Species: M. musculus (mouse)
• Insert Size (bp): 1515
• GenBank ID: NM_007434.3
• Entrez Gene: Akt2 (a.k.a. 2410016A19Rik, PKB, PKBbeta)
• Promoter: CMV
• Tag / Fusion Protein:
  • 3xFlag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GACCTCCATAGAAGACACCGACT
• 3′ sequencing primer: GCCTTATTCCAAGCGGCTTCG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry