Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMSCV-PIG-Lin28b
(Plasmid #64795)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64795 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MSCV PIG
  • Backbone manufacturer
    Scott Lowe
  • Backbone size w/o insert (bp) 7658
  • Total vector size (bp) 8416
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl4
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lin28b
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    758
  • Entrez Gene
    LIN28B (a.k.a. CSDD2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GATGTGGAATGTGTGCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-PIG-Lin28b was a gift from Joshua Mendell (Addgene plasmid # 64795 ; http://n2t.net/addgene:64795 ; RRID:Addgene_64795)
  • For your References section:

    Lin-28B transactivation is necessary for Myc-mediated let-7 repression and proliferation. Chang TC, Zeitels LR, Hwang HW, Chivukula RR, Wentzel EA, Dews M, Jung J, Gao P, Dang CV, Beer MA, Thomas-Tikhonenko A, Mendell JT. Proc Natl Acad Sci U S A. 2009 Mar 3;106(9):3384-9. doi: 10.1073/pnas.0808300106. Epub 2009 Feb 11. 10.1073/pnas.0808300106 PubMed 19211792