-
PurposeCo-expression of human codon-optimized Staphylococcus aureus Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells and other mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4345
- Total vector size (bp) 8398
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSaCas9-2A-GFP
-
Alt nameStaphylococcus aureus Cas9
-
Alt nameSauCas9
-
SpeciesSynthetic
-
Insert Size (bp)4053
- Promoter CAG
-
Tags
/ Fusion Proteins
- 3xFLAG-SV40 NLS (N terminal on insert)
- 2A-GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer ggctctagtgcctctgctaacc
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSaCas9_GFP was a gift from Kiran Musunuru (Addgene plasmid # 64709 ; http://n2t.net/addgene:64709 ; RRID:Addgene_64709)