pFETCH_ATF1
(Plasmid #64689)

• Purpose: Homology Arms and 3X Flag with P2A Neo for 3' tagging of human ATF1
• Depositing Labs: Eric Mendenhall, Richard M. Myers
• Publication: Savic et al Genome Res. 2015 Sep 9.

Backbone

• Vector backbone: pFETCH_Donor
• Backbone size w/o insert (bp): 5771
• Total vector size (bp): 7200
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATF1 Homology Arms
• Alt name: ATF1
• Alt name: TREB-36
• Species: H. sapiens (human)
• Insert Size (bp): 1600
• Entrez Gene: ATF1 (a.k.a. EWS-ATF1, FUS/ATF-1, TREB36)
• Tag / Fusion Protein:
  • 3X Flag P2A Neo (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acgcctgtgaaaccgtacta
• 3′ sequencing primer: aactgttgggaagggcgatc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid has been used along with PX548_ATF1_1 to add a FLAG tag to human ATF1 in HepG2 cells by the Mendenhall and Myers labs at HudsonAlpha Institute for Biotechnology/UAH Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.