Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKT-iRFP-KAN
(Plasmid #64687)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64687 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKT
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5128
  • Modifications to backbone
    The vector backbone is from a pKT vector: Sheff, M. A., & Thorn, K. S. (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21(8), 661-670.
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    iRFP
  • Alt name
    phytochrome-based near-infrared fluorescent protein (iRFP)
  • Insert Size (bp)
    951
  • Mutation
    Nucleotide sequence has been yeast-codon optimized, but there are no amino acid changes.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer ATGGCTGAAGGTTCTGTTGCTAG
  • 3′ sequencing primer GCAACCTGACCTACAGGAAAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKT-iRFP-KAN was a gift from Erin O'Shea (Addgene plasmid # 64687 ; http://n2t.net/addgene:64687 ; RRID:Addgene_64687)
  • For your References section:

    Promoter decoding of transcription factor dynamics involves a trade-off between noise and control of gene expression. Hansen AS, O'Shea EK. Mol Syst Biol. 2013 Nov 5;9:704. doi: 10.1038/msb.2013.56. 10.1038/msb.2013.56 PubMed 24189399