-
PurposepKT vector encoding yeast-codon optimized infrared fluorescent protein iRFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64687 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKT
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 5128
-
Modifications to backboneThe vector backbone is from a pKT vector: Sheff, M. A., & Thorn, K. S. (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21(8), 661-670.
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiRFP
-
Alt namephytochrome-based near-infrared fluorescent protein (iRFP)
-
Insert Size (bp)951
-
MutationNucleotide sequence has been yeast-codon optimized, but there are no amino acid changes.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer ATGGCTGAAGGTTCTGTTGCTAG
- 3′ sequencing primer GCAACCTGACCTACAGGAAAGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKT-iRFP-KAN was a gift from Erin O'Shea (Addgene plasmid # 64687 ; http://n2t.net/addgene:64687 ; RRID:Addgene_64687) -
For your References section:
Promoter decoding of transcription factor dynamics involves a trade-off between noise and control of gene expression. Hansen AS, O'Shea EK. Mol Syst Biol. 2013 Nov 5;9:704. doi: 10.1038/msb.2013.56. 10.1038/msb.2013.56 PubMed 24189399