pKT-iRFP-KAN
(Plasmid #64687)

• Purpose: pKT vector encoding yeast-codon optimized infrared fluorescent protein iRFP.
• Depositing Lab: Erin O'Shea
• Publication: Hansen et al Mol Syst Biol. 2013 Nov 5;9:704. doi: 10.1038/msb.2013.56.

Backbone

• Vector backbone: pKT
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 5128
• Modifications to backbone: The vector backbone is from a pKT vector: Sheff, M. A., & Thorn, K. S. (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21(8), 661-670.
• Vector type: Yeast Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: iRFP
• Alt name: phytochrome-based near-infrared fluorescent protein (iRFP)
• Insert Size (bp): 951
• Mutation: Nucleotide sequence has been yeast-codon optimized, but there are no amino acid changes.

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: ATGGCTGAAGGTTCTGTTGCTAG
• 3′ sequencing primer: GCAACCTGACCTACAGGAAAGA

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry