pKT-SCFP3A-HIS
(Plasmid #64686)

• Purpose: pKT vector encoding yeast-codon optimized and fast-folding cyan fluorescent protein SCFP3A.
• Depositing Lab: Erin O'Shea
• Publication: Hansen et al Mol Syst Biol. 2013 Nov 5;9:704. doi: 10.1038/msb.2013.56.

Backbone

• Vector backbone: pKT
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4738
• Modifications to backbone: The vector backbone is the pKT vector from: Sheff, M. A., & Thorn, K. S. (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21(8), 661-670.
• Vector type: Yeast Expression
• Selectable markers: HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SCFP3A
• Alt name: Cyan fluorescent protein
• Insert Size (bp): 717
• Mutation: Nucleotide sequence has been yeast-codon optimized, but there are no amino acid changes.

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: ATGTCTAAGGGTGAAGAATTGTTC
• 3′ sequencing primer: GCAACCTGACCTACAGGAAAGA

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry