pKT-mCitrineV163A-HIS
(Plasmid #64685)

• Purpose: pKT vector encoding yeast-codon optimized yellow fluorescent protein mCitrine V163A. The V163A mutation confers fast protein maturation.
• Depositing Lab: Erin O'Shea
• Publication: Hansen et al Mol Syst Biol. 2013 Nov 5;9:704. doi: 10.1038/msb.2013.56.

Backbone

• Vector backbone: pKT
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4738
• Modifications to backbone: No modifications. The backbone is from: Sheff, M. A., & Thorn, K. S. (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21(8), 661-670.
• Vector type: Yeast Expression
• Selectable markers: HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCitrine V163A
• Alt name: Yellow fluorescent protein
• Insert Size (bp): 717
• Mutation: Valine 163 changed to alanine

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: ATGTCTAAGGGTGAAGAATTGTTC
• 3′ sequencing primer: GCAACCTGACCTACAGGAAAGA

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry