pMCS-rybozyme-IRES-CAS9
(Plasmid #64668)

• Purpose: Plasmid encoding multiple cloning site, rybozyme and IRES-CAS9.
• Depositing Lab: Wataru Fujii
• Publication: Yoshioka et al Sci Rep. 2015 Dec 16;5:18341. doi: 10.1038/srep18341.

Backbone

• Vector backbone: pCAGGS
• Backbone size w/o insert (bp): 2988
• Total vector size (bp): 8235
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: CAS9
• Species: Synthetic
• Insert Size (bp): 4188
• Tags / Fusion Proteins:
  • Internal ribosome entry site (N terminal on backbone)
  • Flag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: GAAGCCGCTTGGAATAAGGC
• 3′ sequencing primer: ATTTTTGGCAGAGGGAAAAAG

Gene/Insert 2

• Gene/Insert name: HDV ribozyme
• Species: Hepatitis delta virus
• Insert Size (bp): 68
• Tag / Fusion Protein:
  • guide RNA scahold sequence (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GCACATTTCCCCGAAAAGTG
• 3′ sequencing primer: GGCTTCGGCCAGTAACGTTAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The human codon-optimized hCas9 insert in this vector was amplified from plasmid hCas9 (George Church; Addgene #41815).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry