4RFQ
(Plasmid
#64656)
-
PurposeBacterial expression for structure determination; may not be full ORF
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepET28-MHL
-
Backbone manufacturerStructural Genomics Consortium (Addgene Plasmid #26096)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMETTL18:PBC004-E03:C231318
-
Alt nameMETTL18
-
SpeciesH. sapiens (human)
-
MutationSee comments
-
Entrez GeneMETTL18 (a.k.a. AsTP2, C1orf156, HPM1)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7
- 3′ sequencing primer sacBpro-R (agtgaacggcaggtatatgtg) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
4RFQ was a gift from Cheryl Arrowsmith (Addgene plasmid # 64656 ; http://n2t.net/addgene:64656 ; RRID:Addgene_64656)