Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

4RFQ
(Plasmid #64656)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64656 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28-MHL
  • Backbone manufacturer
    Structural Genomics Consortium (Addgene Plasmid #26096)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    METTL18:PBC004-E03:C231318
  • Alt name
    METTL18
  • Species
    H. sapiens (human)
  • Mutation
    See comments
  • Entrez Gene
    METTL18 (a.k.a. AsTP2, C1orf156, HPM1)
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7
  • 3′ sequencing primer sacBpro-R (agtgaacggcaggtatatgtg)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    4RFQ was a gift from Cheryl Arrowsmith (Addgene plasmid # 64656 ; http://n2t.net/addgene:64656 ; RRID:Addgene_64656)