pmax pona 12xTRICK 24xMS2SL
(Plasmid #64542)

• Purpose: TRICK translation biosensor with 12x copies of modified PP7 stem loops and 24x MS2 stem loops.
• Depositing Lab: Jeffrey Chao
• Publication: Halstead et al Science. 2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380.

Backbone

• Vector backbone: pmaxGFP
• Backbone manufacturer: Lonza
• Total vector size (bp): 7175
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 12x PP7 stem-loops
• Species: Synthetic
• Promoter: ponA
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • HA (N terminal on insert)
  • dNP799 (N terminal on insert)
  • 24xMS2 stem loops (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: pCasper-hs GCAACTACTGAAATCTGCCAAG
• 3′ sequencing primer: EBV-rev

Resource Information

• Supplemental Documents:
  • pmax ponA 12xTRICK 24XMS2SL
• Addgene Notes:
  • Addgene diagnostic digest
  • Addgene diagnostic digest
  • Addgene Diagnostic Digest
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Translatable PP7 stem-loops were generated by gene synthesis (Genscript) removing potential stop codons in all three reading frames. The 405 nucleotide stem-loop cassette contained six copies of the PP7 stem-loops and were optimally positioned 40 nucleotides apart to prevent ribosomes stalling at adjacent stem-loops. The PP7 stem-loops were also codon optimized (tRNA abundance and coding potential) and RNA-folding (mfold). The 6x PP7stem-loop cassette was multimerized using SalI and XhoI to generate a cassette with 12 copies of the PP7 stem-loops.

The PP7 stem-loop cassette cloned into a modified version of the pmaxGFP plasmid (Lonza), which contains the CMV immediate early promoter for expression and the β-globin-IgG chimeric intron in the 5′ UTR. The GFP sequence was replaced by NLS-3xHA tagged dNP799 (a fluoregen activating protein). The PP7 stem-loop cassette was fused in-frame to the C-terminus of dNP799. The 24x MS2 stem-loop cassette was cloned downstream of the stop codon of the pp7 stem-loop cassette.

The CMV promoter was replaced by 45 copies of the E/GRE recognition elements (ponA-45) to induce expression of the reporter mRNA in the presence of ponasterone A. The E/GRE elements are bound by a heterodimer of retinoid-X-receptor (RXR) and a synthetic ecodysone receptor (VgEcR).

The final construct contains the following features: ponA-45 - chimeric intron – NLS - 3xHA – dNP799 – 12x PP7 stem-loops – stop codon – 24x MS2 stem-loops – SV40 polyA. See publication for more details.