phage ubc nls ha pcp gfp
(Plasmid #64539)

• Purpose: Used to label reporter mRNAs. Lentiviral expression of the PP7 coat protein fused to EGFP.
• Depositing Lab: Jeffrey Chao
• Publication: Halstead et al Science. 2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380.

Backbone

• Vector backbone: pHAGE-UbiC
• Total vector size (bp): 7385
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PCP
• Alt name: PP7 coat protein
• Species: bacteriophage
• Promoter: human ubiquitin C promoter
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • HA (N terminal on insert)
  • FactorXa site (N terminal on insert)
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: hUBCpro-F2 CGCCGATGATTATATAAGGA
• 3′ sequencing primer: EGFP-N

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry