3xFLAG-dCas9/p-bacteria
(Plasmid #64325)

• Purpose: Expresses 3xFLAG-dCas9 in E. coli in a tetracycline-dependent manner for enChIP analysis to purify specific genomic regions of interest.
• Depositing Lab: Hodaka Fujii
• Publication: Fujita et al BMC Res Notes. 2018 Jun 14;11(1):387. doi: 10.1186/s13104-018-3486-3.

Backbone

• Vector backbone: p15A vector
• Backbone size w/o insert (bp): 2598
• Total vector size (bp): 6777
• Vector type: Bacterial Expression, CRISPR ; Tetracycline-inducible

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 3xFLAG-dCas9
• Species: Synthetic; S. pyogenes
• Insert Size (bp): 4179
• Mutation: D10A, H840A
• Promoter: pLtetO-1
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (not destroyed)
• 3′ cloning site: Xho I (not destroyed)
• 5′ sequencing primer: cgattccgacctcattaagcagc
• 3′ sequencing primer: tgcctggagatccttactcgaGTTAGTCACCTCCTAGCTGACTCAAATCAAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: A portion of this plasmid was derived from a plasmid made by Stanley Qi (Addgene plasmid 44249)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is compatible with gRNA expression plasmids for E. coli, such as Addgene Plasmid #44251 ( http://www.addgene.org/44251 ).

For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/

Plasmid also described in Fujita, T. and Fujii, H., Biochem Biophys Res Commun. 2013 Sep 13;439(1):132-6. doi: 10.1016/j.bbrc.2013.08.013, PMID: 23942116