pBa-FRB-3myc-KIF1B beta tail 387-1770
(Plasmid #64287)

• Purpose: KIF1B beta aa 387-1770 with N-terminal FRB and triple myc tags
• Depositing Labs: Gary Banker, Marvin Bentley
• Publication: Bentley et al J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26.

Backbone

• Vector backbone: pBa-FRB
• Backbone size w/o insert (bp): 6287
• Total vector size (bp): 10569
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KIF1B beta
• Alt name: KIF1B v2
• Species: M. musculus (mouse), R. norvegicus (rat)
• Insert Size (bp): 4282
• Mutation: aa 387-1770, small portion of 5'end matches rat, 3'end matches mouse. V407A, L536I, S542N, Y939C, Q1093R, T1187I, K1691E, and S1766N relative to NM_207682
• GenBank ID: NM_207682
• Entrez Gene: Kif1b (a.k.a. A530096N05Rik, AI448212, AI506502, D4Mil, D4Mil1e, KIF1Bp1, KIF1Bp130, KIF1Bp2, KIF1Bp204)
• Promoter: chicken Beta Actin
• Tags / Fusion Proteins:
  • FRB (N terminal on backbone)
  • 3myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: BclI (not destroyed)
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGAC
• 3′ sequencing primer: GATGAGTTTGGACAAACCAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.