pBa-FRB-3myc-KIF1A tail 391-1698
(Plasmid #64286)

• Purpose: KIF1A aa 391-1698 with N-terminal FRB and triple myc tags
• Depositing Labs: Gary Banker, Marvin Bentley
• Publication: Bentley et al J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26.

Backbone

• Vector backbone: pBa
• Backbone size w/o insert (bp): 5863
• Total vector size (bp): 10365
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KIF1A
• Alt name: FRB-3myc-Kif1A tail
• Species: M. musculus (mouse), R. norvegicus (rat)
• Insert Size (bp): 4502
• Mutation: aa 391-1698, 5'end mostly matches rat, 3'end mostly matches mouse
• GenBank ID: NM_008440 XM_003750741
• Entrez Gene: Kif1a (a.k.a. A, ATSV, C630002N23Rik, Gm1626, Kn, Kns1)
• Entrez Gene: Kif1a
• Promoter: chicken Beta Actin
• Tags / Fusion Proteins:
  • FRB (N terminal on insert)
  • 3myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGAC
• 3′ sequencing primer: GATGAGTTTGGACAAACCAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.