Skip to main content
Addgene

pcDNA3.1 iCasper T2A HO1
(Plasmid #64278)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64278 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5360
  • Total vector size (bp) 7920
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Infrared fluorescent executioner caspase reporter (iCasper) T2A heme oxygenase-1:
  • Alt name
    iCasper T2A HO1
  • Species
    Synthetic
  • Insert Size (bp)
    2560
  • Entrez Gene
    HMOX1 (a.k.a. HMOX1D, HO-1, HSP32, bK286B10)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1 iCasper T2A HO1 was a gift from Xiaokun Shu (Addgene plasmid # 64278 ; http://n2t.net/addgene:64278 ; RRID:Addgene_64278)

  • For your References section:

    Rationally designed fluorogenic protease reporter visualizes spatiotemporal dynamics of apoptosis in vivo. To TL, Piggott BJ, Makhijani K, Yu D, Jan YN, Shu X. Proc Natl Acad Sci U S A. 2015 Mar 17;112(11):3338-43. doi: 10.1073/pnas.1502857112. Epub 2015 Mar 2. 10.1073/pnas.1502857112 PubMed 25733847
Related items:
Commonly requested with: